Axisflying 2024 2/3/5 Inch mini drone under 500 rupees drones for sale $156.80 - $216.50 Min. order: 1 piece Axisflying MANTA5 5inch Fpv Freestyle and racing Drone kit DeadCat-DC O3 Air Unit With GPS $578.20 - $587.90 Min. order: 1 set Related searches 2024 Cheapest S89 Drone ...
Axisflying MANTA5 5inch Fpv Freestyle and racing Drone kit DeadCat-DC O3 Air Unit With GPS $578.20 - $587.90 Min. order: 1 set KN 104 FPV Drone High Capacity Quadcopter 10inch Drone UAV with F405MK2 FC 60A ESC KN 5.8G 2.5W VTX KN3214 730KV Brushless Motor $294.00 - $372.40 Min...
RNA6 PCR template: 5′-GGGAGGACGATGCGGATCAGCCATGTTTACGTCACTCCTTTGGACCACCG CATCTCTACATT-3′. RNA6 5′primer: F1 RNA6 3′primer: 5′-AATGTAGAGATGCGGTGGTCCAAAGGAGTGACGTAAACATG-3′ (R6) For PEP (PSMA aptamer-EGFR siRNA-PSMA aptamer), two RNAs (RNA7 and RNA8) were individually constr...
Alibaba.com strictly prohibits the sale of military drones and dual-use drones on our platform, and we do not support the practice of repurposing civilian drones sold on our platform for military use. For more details, please refer to the relevant section of our Product Listing Policy and Prod...
iFlight Nazgul Evoque F6D V2 Frame Kit 6inch Carbon Fiber DeadCat HD/Analog compatible with DJI O3 Air Unit for FPV Freestyle $71.00 - $99.00 Min. order: 1 box Digital Binoculars Telescope Photo Video Camera for Hiking Climbing $491.00 Min. order: 5 boxes Hot sale Onick VP-1200Pro D...
Alibaba.com strictly prohibits the sale of military drones and dual-use drones on our platform, and we do not support the practice of repurposing civilian drones sold on our platform for military use. For more details, please refer to the relevant section of our Product Listing Policy and Prod...
Alibaba.com strictly prohibits the sale of military drones and dual-use drones on our platform, and we do not support the practice of repurposing civilian drones sold on our platform for military use. For more details, please refer to the relevant section of our Product Listing Policy and Prod...
iFlight Chimera7 Pro V2 Analog 7.5inch BNF FPV drones 5.8G 1.6W/2.5W VTX Playload 2KG GPS long distance professional for fpv $370.00 - $469.00 Min. order: 1 piece Nazgul DC5 ECO 6S HD 5inch 6S Freestyle BNF O3 Air Unit With BLITZ ATF435 Stack O3 Air Unit Aerial Photography FPV Dron...
Pfly 3112 900KV 1050KV 5-8S Brushless Motor for FPV Racing Long Range X Class Drone $12.00 - $15.00 Min. order: 10 pieces Walksnail Avatar HD Camera / VTX Kit 1080P 170 FOV Lower Latency Onboard DVR 4KM Range for Avatar FatShark HD Dominator ...
Creative cartoon cute kt cat key chain bag pendant car key chain wholesale promotional keychains $0.64 - $0.75 Min. order: 10 pieces New New One Piece Keychain Luffy Essolon Key Chain Doll Key Ring Pendant pvc rubber keychains $0.60 - $0.69 ...