coli O157:H7 strain EDL933 (ATCC 700927) using primers StxBNStart (5’ GGATCCCATATGAAAAAAACATTATTAATAGCTGCATC 3’), StxXhoHind (5’ AAGCTTCTCGAGACGAAAAATAACTTCGCTGAATCC 3’) and cloned into NdeI-HindIII sites of pET21b(+) plasmid (Novagen). The pET21b-stx1B construct was introduced...
题目While small may be beautiful,tall is just plain uncomfortable it seems,particularly when it comes to staying in hotels and eating in restaurants. The Tall Persons Club Great Britain (TPCGB),which was formed six months ago to campaign for the needs of the tall,has turned it...
题目Most of us might only begin to think about dinner in the late afternoon:What should I make today?But Jelena Petrovic begins to think about her big meal early each morning.After morning tea,she and her husband,Milan,begin their plans for a traditional Serbian dish.The ...